Question 1

What are the steps (in the correct order) that link a change in the base sequence of a gene to a change in the phenotype of an organism like a mouse or a human?

Accepted Answer

DNA--> RNA --> Protein This is the central dogma, which summarizes the flow of information in cells from DNA (genes) to proteins. For genes that encode RNAs that do not function as mRNAs, only the DNA&mdash;>RNA step occurs.

Question 2

In eukaryotic cells, translation occurs in the ________.

Accepted Answer

cytoplasm. RNA must leave the nucleus for translation.

Question 3

Identify the start and stop codons in the mRNA sequence 5'-UAUCCAUGGCACUUUAAAC-3'. What is the resulting amino acid sequence?

Accepted Answer

Start codon: AUG; stop codon: UAA; protein: Met-Ala-Leu-stop. The start codon is AUG, and there are three possible stop codons: UAA, UAG, and UGA.

Question 4

In Figure 16.7b, what would be the base sequence of the mRNA and the amino acid sequence of the protein if the bottom DNA strand serves as the template for transcription? (Look at figures)

Accepted Answer

mRNA: 5'AUGCUGGAGGGGGUUAGACAU3' Protein: Met-Leu-Glu-Gly-Val-Arg-His

Question 5

Each codon shown below specifies an amino acid. For which one is it possible that a change in a single base could create a stop codon?

Accepted Answer

AAA.Changing the first base from A&mdash;>U creates the stop codon UAA.

Question 6

A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is _____.

Accepted Answer

3' UCA 5'

Question 7

Codons are part of the molecular structure of _____.

Accepted Answer

mRNA

Question 8

Consider the following section of mRNA:UCUGAUGGGCUUUBeginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? Consult the codon table provided if necessary.

Accepted Answer

methionine, glycine, phenylalanine

Question 9

True or false? A codon is a group of three bases that can specify more than one amino acid.

Accepted Answer

False. A codon is a group of three bases that can specify only one amino acid.

Question 10

Which of the following statements about mutations is false?A.) A knock-out mutation results in a total absence of the mutated protein.B.) Addition and deletion mutations disrupt the primary structure of proteins.C.) A deletion mutation results in the loss of a base in the DNA sequence.D.) An addition mutation results in an added base in the DNA sequence.

Accepted Answer

A knock-out mutation results in a total absence of the mutated protein. A knock-out mutation refers to the loss of a protein's function but not necessarily to its complete absence.

Question 11

If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred?

Accepted Answer

Deletion. The original sequence has lost the base C.

Question 12

Which mutation(s) would not change the remainder of the reading frame of a gene sequence that follows the mutation(s)?

Accepted Answer

One addition and one deletion mutation.This combination results in no net change in the number of bases, so the reading frame would eventually be restored.

Question 13

If the sequence ATGCATGTCAATTGA were mutated such that a base were inserted after the first G and the third T were deleted, how many amino acids would be changed in the mutant protein?

Accepted Answer

Two.The second and third codons in the new sequence are different from the original codons.

Question 14

If a mutated DNA sequence produces a protein that differs in one central amino acid from the normal protein, which of the following kinds of mutations could have occurred?

Accepted Answer

An addition mutation and a deletion mutation.If the mutations occur within the same codon, only that codon (amino acid) will be altered.

Question 15

A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence phe-leu-ile-val would be ________.

Accepted Answer

3' AAA-GAA-TAA-CAA 5'

Question 16

If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides:5' - ACTACGTGA - 3'Sort the following replicated DNA sequences by the type of point mutation each contains (frameshift, base substitution, or neither), as compared to the correct sequence shown above.

Accepted Answer

Frameshift:5'-ACTCGTGA-3', 5'-ACTTACGTGA-3'Base Substitution: 5'-ACTACGTGT-3', 5'-ACTAAGTGA-3'

Question 17

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

Accepted Answer

a frameshift deletion at the beginning of the gene.A frameshift mutation at the beginning of a gene would affect every codon after the point where the mutation occurred. During protein synthesis, incorrect amino acids would be inserted from the point where the frameshift mutation occurred on; the resulting protein would most probably be nonfunctional. For this reason, a frameshift mutation at the beginning of a gene is generally the most severe type of mutation.

Question 18

A mutation that results in premature termination of translation _____.

Accepted Answer

is a nonsense mutation.

Question 19

Which of the following is an exception to the central dogma?

Accepted Answer

the discovery of RNA viruses that synthesize DNA using reverse transcriptase

Question 20

All three domains (Bacteria, Archaea, and Eukarya) follow the same genetic code. Therefore, which of the following statements would most likely be correct?

Accepted Answer

The genetic code evolved before the different domains diverged.

Mastering Biology Ch. 16

Unlock all answers in this set

Haven't found what you need?