Chapter 7: Biology

Griffith -- DNA is composed of complementary strands

nucleotide, gene, chromosome, genome

cytoplasm, a protein

it has thymine instead of uracil

protein

It encodes a sequence of amino acids.

introns are removed

the repressor protein

point mutation

recombinant DNA

Harmless bacteria can acquire the ability to cause disease

15% guanine (G)

complementary

genome, chromosome, genes

TACAACGTAAT

Replication is always 100% accurate.

reverse transcriptase

gene therapy

RNA antisense

Natural selection caused the mutation in the FOXP2 gene in early humans.

Griffith's research established that a then-unknown molecule in a lethal strain of bacteria could transform nonlethal bacteria, making them able to kill mice. Avery and his colleagues added enzymes that destroyed either proteins or DNA to the mixtures that Griffith used in his experiments. In Avery's experiments, mice died only from bacterial solutions mixed with enzymes that destroyed proteins. Mice did not die from bacterial solutions mixed with enzymes that destroyed DNA. These experiments showed that DNA, not protein, changed bacteria from nonlethal to lethal.

The Hershey-Chase "blender experiments" used radioactive sulfur to label the protein coats of one batch of bacteriophages and used radioactive phosphorus to label the DNA of another batch of bacteriophages. Both batches of viruses were allowed to infect bacteria. Then the solutions were separately blended at high speeds to separate viral protein coats from bacterial cells. Radioactively labeled bacteria were only found in the batches that had been infected by phages with radioactively labeled DNA. The protein-labeled phages did not transmit radioactivity to the bacteria they had infected. These experiments confirmed that DNA, not protein, is the genetic material.

The components of a DNA molecule are nucleotides. These are composed of a deoxyribose sugar bonded to a phosphate and a nucleotide base (adenine, thymine, cytosine, or guanine). The three-dimensional structure of DNA is a double helix, which resembles a twisted ladder.

The evidence included Rosalind Franklin's X-ray diffraction photo of a crystal of DNA, plus Erwin Chargaff's work that showed that DNA contains equal amounts of adenine and thymine and equal amounts of cytosine and guanine.

The 5' end has the 5th numbered carbon in deoxyribose facing out and leading with a phosphate group attached, and the 3' end has the 3rd numbered carbon leading with no phosphate, just the OH attached to the carbon.

A gene is a strand of DNA that encodes a protein.

Transcription and translation are the two main stages in protein synthesis

Messenger RNA (mRNA) carries the DNA instructions for building the protein, transfer RNA (tRNA) carries the appropriate amino acid to the ribosome, and ribosomal RNA (rRNA) is the major component of a ribosome, the structure that reads codons on the mRNA and assembles amino acids into polypeptides

The steps of transcription are initiation, elongation of the RNA molecule, and termination. During initiation, enzymes unzip the DNA and RNA polymerase binds. During elongation, RNA polymerase "reads" the DNA strand and adds complementary nucleotides to the growing RNA strand. During termination, synthesis of the RNA molecule ends and the DNA molecule reforms.

Transcription occurs in the nucleus

RNA polymerase uses the DNA template to bind additional RNA bases into the growing chain of RNA being transcribed

The promoter signals the start of a gene, and the terminator signals the end of a gene. RNA polymerase recognizes the promoter and terminator, so it starts and stops transcription at the correct positions

Before it leaves the nucleus of a eukaryotic cell, mRNA is altered in the following ways: - a cap is added to the 5' end of the mRNA molecule; - a poly A tail is added to the 3' end; - introns are removed and exons are spliced together.

Researchers knew that life uses four nucleotides and 20 amino acids. They reasoned that the genetic code could not reflect 1-base or 2-base "words," because neither could encode enough amino acids. A triplet code (3-base "words") could potentially encode 64 amino acids, which is more than enough for the 20 amino acids found in biological proteins. They deciphered the genetic code by adding synthetic mRNA molecules to test tubes containing all the ingredients needed for translation. They analyzed the sequences of the resulting polypeptides to determine which codons correspond to which amino acids

The steps of translation are initiation (ribosomal subunit binds to initiator codon), elongation of the polypeptide, and termination (release of the last tRNA from the ribosome, signified by a stop codon).

Translation occurs at ribosomes, which are either free in the cytoplasm or attached to the rough ER

Polypeptides have to be folded into proteins; sometimes amino acids are cut out of the chain, and sometimes multiple polypeptides join together.

Protein production costs a lot of energy; the regulation of gene expression avoids the production of unnecessary proteins and therefore saves energy

A repressor protein binds to an operator and prevents the genes in the operon from being transcribed

Transcription factors bind to certain DNA sequences to regulate transcription, for example by preparing a promoter site to bind RNA polymerase. Transcription won't occur without these factors. Enhancers are sequences of DNA outside of the promoter. Transcription factors can bind to the enhancers to help regulate gene expression

Cells can keep DNA coiled or attach methyl groups to inactivate genes. During transcription different introns can be spliced out. mRNA can be contained in the nucleus or rapidly degraded. Proteins can also be degraded or modified in processing

A mutation is a change in the DNA sequence of a cell

A point mutation changes one or a few base pairs of genes. Point mutations include substitution mutations (which replace one DNA base for another), insertions, and deletions. Substitution mutations might change one amino acid to another in the encoded protein (which is called a missense mutation), might change an amino acid to a stop codon (which is called a nonsense mutation), or might not change an amino acid (which is called a silent mutation). Insertions of deletions of more or fewer than three nucleotides will shift the "reading frame" of the gene; these frameshift mutations might alter many amino acids in the protein, drastically changing its shape and function. An insertion of three nucleotides adds one amino acid to the encoded protein. A deletion of three nucleotides removes one amino acid from the encoded protein. Expanding repeat mutations increase the number of copies of three-or four-nucleotide sequences over several generations. This causes extra amino acids to be inserted into a protein, deforming it.

Mutations are caused by DNA replication errors, errors in crossing over during meiosis, chromosome inversions and translocations, or exposure to chemicals or radiation.

A germline mutation is one that occurs in a cell that will give rise to a sperm or an egg cell. A somatic mutation occurs within a non-germline body cell.

Mutations are used to learn how genes normally function and to develop new varieties of crop plants. Mutations can also be used to trace the evolution of viruses and other infectious agents

The 25,000 or so genes can make 400,000 proteins in part by changing which introns are removed prior to splicing together the mRNA.

Some of the 98.5% of the human genome that does not code for protein encodes rRNA, tRNA, and regulatory sequences that control gene expression. It also contains pseudogenes that may be remnants of non-functional DNA that encoded proteins in our ancestors; transposons (transposable elements) that jumped from bacteria and viruses to humans; and tandem repeats of DNA sequences in telomeres, centromeres, and on the Y chromosome.

Recombinant DNA is the combined DNA from 2 or more organisms

Transgenic organisms are organisms that contain recombinant DNA. They produce drugs and other useful chemicals, degrade pollutants, incorporate pesticides in their tissues, are models for medical research, and secrete human proteins

The steps in creating a recombinant plasmid include: - using restriction enzymes to cut out the gene sequence from donor DNA; - cutting the plasmid with the same restriction enzymes; - allowing the donor sequence to combine with the plasmid DNA.

Bacteria, plant, and animal cells are sometimes induced to take up recombinant DNA by exposure to electricity. Scientists also make cells take up new DNA by shooting it into cells with gene guns, inserting it into liposomes, and inserting it as plasmids into bacteria that enter plant cells and inject the plasmids

Gene therapy replaces faulty genes in the genome with functioning copies. Some challenges are in directly delivering the gene to the specific cell that needs to express it, having that expression last long enough to affect a cure, and not have the viral delivery method trigger illness itself.

Antisense RNA silences genes by adding an artificial complementary strand of RNA to mRNA, making it a double strand. Ribosomes cannot translate double-stranded mRNA. Gene knockouts silence genes by replacing a normal copy of a gene with a disabled version that will not be transcribed

DNA microarrays can be used to quickly determine whether a particular gene or protein is present in a cell. In more practical terms, they can tell how a cancer patient will respond to a cancer drug and whether the drug will be effective against the cancer. DNA microarrays also can be used to predict how effective an antibiotic will be against a particular strain of bacteria.

Researchers wanted to know what and when mutations arose in the FOXP2 gene. They also wanted to know if these mutations could be linked to human acquisition of language

One possible insight: Researchers could mutate the FOXP2 gene so that it is non-functional at different stages of development to learn whether it is actively important through all of development or just in a critical window. Such an experiment would not be ethical.

DNA is a double helix that resembles a twisted ladder. In this molecule, the "twin rails" of the ladder are alternating units of deoxyribose and phosphate, and the ladder's rungs are A-T and G-C base pairs joined by hydrogen bonds

If protein were the genetic material, the bacteria infected by the sulfur-labeled virus would have become radioactive.

T C G A G A A T C T C G A T T a) AGCTCTTAGAGCTAA C C G T A T A G C C G G T A b) CGGCATATCGGCCATG

From smallest to largest, the order is nitrogenous base, nucleotide, codon, gene, chromosome, nucleus, and cell.

The function of much of the DNA in a cell is not known, but some of it encodes the cell's RNA and proteins.

RNA nucleotides contain a sugar called ribose; DNA nucleotides contain a similar sugar called deoxyribose. RNA has the nitrogenous base uracil, which behaves similarly to the thymine in DNA - that is, both uracil and thymine form complementary base pairs with adenine. RNA can be single-stranded; DNA is double-stranded. RNA can catalyze chemical reactions, a role not known for DNA.

Transcription copies the information encoded in a DNA base sequence into the complementary language of mRNA. Once transcription is complete and mRNA is processed, the cell is ready to translate the mRNA message into a sequence of amino acids that builds a protein. Transcription occurs in the nucleus, and translation occurs at ribosomes in the cytoplasm

Messenger RNA (mRNA) carries the information that specifies a protein. Ribosomal RNA (rRNA) combines with proteins to form a ribosome, the physical location of protein synthesis. Transfer RNA (tRNA): molecules are "connectors" that bind mRNA codons at one end and specific amino acids at the other. Their role is to carry each amino acid to the ribosome at the correct spot along the mRNA molecule.

The complementary sequences are: a) AAUGUGAACGAACUCUCAA; b) CCUUAUGCAGAUCGAUCGU

The complementary sequences are: a) CACCGCATAAGAAAAGGCCCATCC; b) TCCTTTTGGGGAGAATAATATCTA

UGG to CGG; b) GGU to GUU; GGC to GUC; GGA to GUA; GGG to GUG; c) UAU to CAU; UAC to CAC