Question 1

To produce a DNA fragment that contains the whole gene and has two sticky ends, where must the enzyme's restriction sites be located?

Accepted Answer

outside the gene on both sides, but not inside the gene

Question 2

Which enzyme(s) will produce a DNA fragment that contains the entire vgp gene (shown in red) and has sticky ends?Select all that apply.

Accepted Answer

HindIIIBamHI(Cloning the vgp gene requires an enzyme that has restriction sites on both sides of that gene but not within the gene. Two enzymes, HindIII and BamHI, satisfy that requirement, while also producing DNA fragments that have sticky ends. Sticky ends make it possible for the fragments to combine with the DNA of a cloning vector, such as a plasmid.)

Question 3

For the first time, the U.S. Food and Drug Adminis

Accepted Answer

food from a genetically altered animal

Question 4

The fish in the video have been genetically engineered to _____.

Accepted Answer

grow faster

Question 5

The modified salmon were created by _____.

Accepted Answer

adding genetic material from a Pacific salmon and an eel-like fish

Question 6

According to the producers of the genetically modified salmon, the meat _____.

Accepted Answer

looks and tastes the same as unmodified salmon

Question 7

What concerns do some consumer groups have about genetically modified fish?

Accepted Answer

They want food from genetically modified fish to be clearly labeled as genetically modified.They want to prevent genetically modified fish from breeding with wild fish.They want more studies on the health effects that genetically modified fish may have on people who eat it.

Question 8

How does the company raising these fish claim to prevent the genetically modified fish from breeding with wild fish?

Accepted Answer

The genetically modified fish are sterile.

Question 9

Folk singer Woody Guthrie died of Huntington's disease, an autosomal dominant disorder. Which statement below must be true?

Accepted Answer

It is very likely that at least one of Woody Guthrie's parents also have had the allele for Huntington's disease.(Unless the disease is caused by a new mutation, which is quite rare, individuals with a dominant condition must have inherited the dominant allele from one of their parents. As it happens, Guthrie's mother also died of Huntington's disease.)

Question 10

Various procedures can be used to detect genetic disorders before birth. Among the tests discussed in this chapter, which is the least invasive (list first), and which two allow the chromosomes of the fetus to be examined?

Accepted Answer

ultrasound imaging ... chorionic villus sampling ... amniocentesis(Both CVS and amniocentesis involve the preparation of a karyotype using fetal cells.)

Question 11

In order to insert a human gene into a plasmid, both must _____

Accepted Answer

be cut by the same restriction enzyme(Doing so will result in the formation of complementary sticky ends.)

Question 12

What enzyme forms covalent bonds between restriction fragments?

Accepted Answer

DNA ligase(DNA ligase catalyzes the formation of covalent bonds between restriction fragments.)

Question 13

The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____.

Accepted Answer

sticky ends

Question 14

The sticky end of the DNA restriction fragment shown here will pair with a DNA restriction fragment with the sticky end _____.The figure shows the part of the DNA. One strand from left to right reads T G C A G A A T T C. The second strand, which is complementary to the first, reads backwards C T T A A G, excluding the first four nucleotides.

Accepted Answer

-ACGT

Question 15

What information can not be obtained from the sequence of a gene?

Accepted Answer

Whether the gene is methylated.

Question 16

What is the polymerase chain reaction (PCR)?

Accepted Answer

A method to amplify a fragment of DNA(PCR is an in vitro DNA synthesis reaction that produces many copies of a single DNA fragment.)

Question 17

True or false? Comparison of the sequences of the same gene across species can give some insight into the existence of a common ancestor with that gene.

Accepted Answer

True(DNA sequence comparisons are a powerful tool by which to estimate how closely related different species are along the evolutionary timeline.)

Question 18

True or false? The Taq enzyme is a type of DNA polymerase that allows researchers to separate the DNA strands during the annealing step of the PCR cycle without destroying the polymerase.

Accepted Answer

False(Taq polymerase is derived from a species of bacteria living in hot springs, which makes it stable at the high temperature required for the denaturation step of PCR.)

Question 19

How many DNA molecules would there be after four rounds of PCR if the initial reaction mixture contained two molecules?

Accepted Answer

32

Question 20

During which step in the PCR cycle are nucleotides used?

Accepted Answer

Extension.(Nucleotides are used to synthesize the complementary strand to the DNA template during the extension step.)

Question 21

During which step in the PCR cycle do primers form bonds with a single-stranded template?

Accepted Answer

Annealing.(Primers form hydrogen bonds with the single-stranded DNA template during the annealing step.)

Question 22

In this example the marker DNA includes fragments that have 23,130, 9,416, 6,557, 4,361, 2,322, 2,027, and 564 base pairs. Approximately how many base pairs are in the DNA fragment indicated by the letter A?The figure shows the results of gel electrophoresis. In this figure, the marker DNA has seven bands; their lengths are 23130, 9416, 6557, 4361, 2322, 2027, and 564 base pairs respectively. The first researched DNA has two bands. The first, indicated by the letter A, complies to the third band of the marker DNA and the second is located between the sixth and the seventh bands of the marker DNA. The second researched DNA has three bands. The first, indicated by the letter B, is located between the third and the fourth bands of the marker DNA and two others are located between the sixth and the seventh bands.

Accepted Answer

6,557

Question 23

In this example the marker DNA includes fragments that have 23,130, 9,416, 6,557, 4,361, 2,322, 2,027, and 564 base pairs. Approximately how many base pairs are in the DNA fragment indicated by the letter B?The figure shows the results of gel electrophoresis. In this figure, the marker DNA has seven bands; their lengths are 23130, 9416, 6557, 4361, 2322, 2027, and 564 base pairs respectively. The first researched DNA has two bands. The first, indicated by the letter A, complies to the third band of the marker DNA and the second is located between the sixth and the seventh bands of the marker DNA. The second researched DNA has three bands. The first, indicated by the letter B, is located between the third and the fourth bands of the marker DNA and two others are located between the sixth and the seventh bands.

Accepted Answer

between 6,557 and 4,361 base pairs

Question 24

DNA fragment B consists of _____ base pairs.The figure shows the results of gel electrophoresis. In this figure, the DNA two has three bands. The length of the first band is 4796, the length of the second is 1405, and the length of the third is 1268. Letter A indicates the second band. The third band is indicated by letter B.

Accepted Answer

1,405

Question 25

Which of these DNA molecules is the shortest?

Accepted Answer

E(The shorter the DNA molecule, the farther it moves.)

Question 26

In gel electrophoresis DNA molecules migrate from _____ to _____ ends of the gel.

Accepted Answer

negative ... positive(An electrical current is generated across the gel, and DNA molecules migrate from the negative end toward the positive end.)

Question 27

This is a DNA fingerprint exhibiting samples from a victim, two suspects, and the crime scene. Which of these DNA fragments is common to both the victim and Suspect 1?

Accepted Answer

B(A visual comparison of the gel electrophoresis results should reveal that Suspect 1 has a DNA fragment that matches victim DNA fragment B.)

Question 28

This is a DNA fingerprint exhibiting samples from a victim, two suspects, and the crime scene. Which of these DNA fragments is common to both the victim and Suspect 2?

Accepted Answer

C(A visual comparison of the gel electrophoresis results should reveal that Suspect 2 has a DNA fragment that matches victim DNA fragment C.)

Question 29

Why is Suspect 1 considered more likely to have committed the crime than Suspect 2?

Accepted Answer

The crime scene sample contains DNA fragments from both the victim and Suspect 1.(Such a good match between crime scene DNA fragments and Suspect 1 DNA fragments strongly suggest that Suspect 1 committed the crime.)

Question 30

Which of the following tools of recombinant DNA technology is incorrectly paired with its use?reverse transcriptase - production of cDNA from mRNADNA ligase - enzyme that cuts DNA, creating the sticky ends of restriction fragmentselectrophoresis - separation of DNA fragmentsrestriction enzyme - production of RFLPsDNA polymerase - used in a polymerase chain reaction to amplify sections of DNA

Accepted Answer

DNA ligase - enzyme that cuts DNA, creating the sticky ends of restriction fragments

Question 31

Which of the following would not be true of cDNA produced using human brain tissue as the starting material?

Accepted Answer

It could be used to create a complete genomic library.

Question 32

A paleontologist has recovered a bit of tissue from the 400-year-old preserved skin of an extinct dodo (a bird). The researcher would like to compare a specific region of the DNA from the sample with DNA from living birds. Which of the following would be most useful for increasing the amount of dodo DNA available for testing?

Accepted Answer

polymerase chain reaction (PCR)

Question 33

Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problem of

Accepted Answer

post-transcriptional processing.

Question 34

DNA technology has many medical applications. Which of the following is not done routinely at present?genetic testing for carriers of harmful allelesprenatal identification of genetic disease genesproduction of hormones for treating diabetes and dwarfismintroduction of genetically engineered genes into human gametesproduction of viral proteins for vaccines

Accepted Answer

introduction of genetically engineered genes into human gametes

Question 35

In recombinant DNA methods, the term vector can refer to

Accepted Answer

a plasmid used to transfer DNA into a living cell.

Question 36

Which of the following is an example of recombinant DNA technology?

Accepted Answer

introducing a human gene into a bacterial plasmid(Recombinant DNA technology involves combining DNA from different sources into a single molecule, such as inserting a gene from one species into a plasmid from another.)

Question 37

In recombinant DNA experiments, _____ is used to cut pieces of DNA and _____ joins the resulting fragments to form recombinant DNA.

Accepted Answer

a restriction enzyme ... DNA ligase(Restriction enzymes cut DNA molecules at specific points; in most cases, the restriction fragments have sticky ends that can base-pair with complementary sticky ends. The joined segments are then covalently fused by DNA ligase.)

Question 38

Archaeologists unearthed a human skull with a small dried fragment of the scalp still attached. They extracted a tiny amount of DNA from the scalp tissue. How could they obtain sufficient DNA for an analysis of the ancient human's genes? (Concept 20.1)

Accepted Answer

Use the polymerase chain reaction(PCR is a method of DNA amplification.)

Question 39

cDNA is synthesized from _____ using an enzyme called _________

Accepted Answer

mRNA ... reverse transcriptase(Reverse transcriptase is a viral enzyme that can synthesize DNA from an RNA template.)

Question 40

The ingredients for PCR and for the dideoxy chain-termination method of DNA sequencing are both similar and include __________.

Accepted Answer

Free nucleotides, DNA polymerase, DNA primers(If DNA polymerase encounters a DNA template strand with a primer attached to it, and free nucleotides are available, DNA synthesis will proceed.)

Question 41

Gel electrophoresis separates DNA fragments on the basis of ________.

Accepted Answer

length(As the DNA fragments move through the gel, longer fragments are impeded more than shorter fragments, producing characteristic banded patterns in the gel.)

Question 42

If cells from a carrot are removed and placed in a culture medium, they can develop into a normal adult plant. This demonstrates that carrot cells _____.

Accepted Answer

retain all the genes that were in the zygote that developed into the original plant(Furthermore, the carrot cells are totipotent.)

Question 43

Which of the following is true of stem cells?

Accepted Answer

They can be found in both embryonic and adult tissues.Their use is highly controversial.They can differentiate to produce many different kinds of specialized cells.They can reproduce indefinitely in culture.

Question 44

You are a member of the jury for a murder case. The prosecution has presented DNA evidence linking the defendant to the crime scene. The defense claims that DNA evidence using STR analysis with 13 markers is not sufficient to reliably distinguish between people. What do you think? (Concept 20.4)

Accepted Answer

The prosecution is right. STR analysis with 13 markers gives a 1 in 10 billion or greater chance that two people will have the same pattern. This person was at the crime scene.(Given the current population of the Earth, STR analysis with 13 markers should be sufficient to distinguish between any two people (excluding identical twins, of course) on the planet.)

Question 45

What is the most commonly used vector for introducing transgenes into plants?

Accepted Answer

The Ti plasmid(The Ti plasmid comes from Agrobacterium tumefaciens, and it is effective at integrating with the host cell's DNA.)

Question 46

DNA fragment A consists of _____ base pairs.The figure shows the results of gel electrophoresis. In this figure, the DNA two has three bands. The length of the first band is 4796, the length of the second is 1405, and the length of the third is 1268. Letter A indicates the second band. The third band is indicated by letter B.

Accepted Answer

1,268

Question 47

Which of these genes are located on the q arm of chromosome 17?The figure shows the human chromosome. On the short arm of this chromosome, there are several genes. From top to bottom, they are RP13, TP53, GLUT4. On the long arm, there are BLMH, SLC6A4, KRTHA1, Gastrin, GH1, DCP1, MPO genes.

Accepted Answer

gastrin and GH1(The q arm is the long arm of a chromosome.)

Question 48

The RP13 gene of chromosome 17 codes for a protein _____.

Accepted Answer

involved in eye development(The RP13 gene codes for a protein that plays a role in eye development.)

Question 49

The gene that codes for gastrin is located on the _____ of chromosome 17.The figure shows the human chromosome. On the short arm of this chromosome, there are several genes. From top to bottom, they are RP13, TP53, GLUT4. On the long arm, there are BLMH, SLC6A4, KRTHA1, Gastrin, GH1, DCP1, MPO genes.

Accepted Answer

q arm(The gene that codes for gastrin is located on the long arm of chromosome 17.)

Question 50

The TP53 gene of chromosome 17 codes for a protein _____.

Accepted Answer

involved in the regulation of the cell cycle

Question 51

Which of these genes codes for a protein that plays a role in growth?

Accepted Answer

GH1(GH stands for growth hormone.)

Question 52

Which of these genes codes for a protein that plays a role in white blood cell function?

Accepted Answer

MPO(This gene codes for a protein that plays a role in white blood cell function)

Question 53

What are the steps in the shotgun approach to whole-genome sequencing?

Accepted Answer

1. Multiple copies of the same chromosome are prepared2. Chromosome copies are broken into 1-kb fragments3. 1-kb fragments are cloned into plasmids4. The plasmids are sequenced5. A computer combines the fragmented sequences

Question 54

In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?Sequences of DNA fragmentsGATGACCGATGCGGGCGTCAGGACATGGCTCAGTCGA

Accepted Answer

GATGACATGGCGTCAGTCGATGCG

Question 55

Bioinformatics includes all of the following except:analyzing protein interactions in a species.use of mathematical tools to make sense of biological systems.development of computer-based tools for genome analysis.using molecular biology to provide biological information to a system so that it gets expressed.using computer programs to align DNA sequences.

Accepted Answer

using molecular biology to provide biological information to a system so that it gets expressed.

Question 56

Which of the following has the largest genome and the fewest genes per million base pairs?Saccharomyces cerevisiae (yeast)Haemophilus influenzae (bacterium)Arabidopsis thaliana (plant)Homo sapiens (human)Drosophila melanogaster (fruit fly)

Accepted Answer

Homo sapiens (human)

Question 57

One of the characteristics of retrotransposons is that

Accepted Answer

they code for an enzyme that synthesizes DNA using an RNA template.

Question 58

Multigene families are

Accepted Answer

identical or similar genes that have evolved by gene duplication.

Question 59

Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this phenomenon?

Accepted Answer

exon shuffling

Question 60

Homeotic genes

Accepted Answer

encode transcription factors that control the expression of genes responsible for specific anatomical structures

Question 61

Although quite different in structure, plants and animals share some basic similarities in their development, such as

Accepted Answer

a cascade of transcription factors that regulate gene expression on a finer and finer scale.

Question 62

The main goal of the Human Genome Project (HGP) was to ________.

Accepted Answer

map all the human genes and determine the nucleotide sequence of the entire human genome

Question 63

BLAST is a computational tool used by genome biologists to_________.

Accepted Answer

compare a given DNA or protein sequence to all other DNA or protein sequences in a database

Question 64

Which of the following statements about genome sizes is true?The human genome is the largest and most complex.Large animals have larger genomes than plantsMost eukaryotes have larger genomes than most prokaryotes.Species within a phylogenetic group such as flowering plants or insects have similar genome sizesAll of the above statements are true

Accepted Answer

Most eukaryotes have larger genomes than most prokaryotes.(The only exceptions may be intracellular parasites whose genomes have undergone reduction because they are dependent on their hosts for many functions.)

Mastering 16

Unlock all answers in this set

Haven't found what you need?