Exam 3 Quiz Questions

Which process produces oxygen? a) cellular respiration b) photosynthesis

Which set of reactions uses H2O and produces O2? a) light independent reactions b) light dependent reactions

What is the importance of the light-independent reactions in terms of carbon flow in the biosphere? a) The light-independent reactions turn glucose, a sugar, into CO2 gas. b) The light-independent reactions use CO2 to make ATP. c) The light-independent reactions turn CO2, a gas, into usable carbon in the form of sugars. d) The light-independent reactions turn sugar into ATP for energy.

True or false? The light-dependent reactions of photosynthesis use water and produce oxygen.

Which of the following molecules is the primary product of photosystem I? a) Carbon dioxide b) Oxygen c) NADPH d) ATP

What is the biological significance of the light-independent reactions of photosynthesis? a) They generate ATP and NADPH. b) They make oxygen. c) They convert ATP to sugar. d) They convert carbon dioxide to sugar.

Which of the following statements best describes the relationship between the light-dependent and light-independent reactions of photosynthesis? a) The light-independent reactions release energy, and the light-dependent reactions require energy. b) The light-dependent reactions produce carbon dioxide, which is then used by the light-independent reactions. c) The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions. d) The light-dependent reactions pass electrons through an electron transport chain to the light-independent reactions.

Which of the following reactions ensures that the Calvin cycle can make a continuous supply of glucose? a) Production of 3-phosphoglycerate b) Regeneration of RuBP c) Carbon fixation d) Production of G3P

Select the correct molecule that is the main product of the Calvin cycle. a) NADPH b) G3P c) Glucose

What is the basic role of CO2 in photosynthesis? a) CO2 is taken in by plants as a form of inverse respiration, in which carbon dioxide is "breathed in" and oxygen is "breathed out." b) CO2 is fixed or incorporated into organic molecules. c) CO2 is a source of electrons in the formation of organic molecules.

What is the basic function of the light reactions of photosynthesis?

Which of these is a difference between a DNA and an RNA molecule? a) DNA contains five-carbon sugars, whereas RNA contains six-carbon sugars. b) DNA is double-stranded, whereas RNA is single-stranded. c) DNA is a polymer composed of nucleotides, whereas RNA is a polymer composed of nucleic acids. d) DNA contains nitrogenous bases, whereas RNA contains phosphate groups. e) DNA contains uracil, whereas RNA contains thymine.

What are pyrimidines?

In a nucleotide, the nitrogenous base is attached to the sugar's _____ carbon and the phosphate group is attached to the sugar's _____ carbon.

Nucleic acids are assembled in the _____ direction.

In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.

After DNA replication is completed, _____.

The first step in the replication of DNA is catalyzed by _____.

The action of helicase creates _____.

Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments?

The synthesis of a new strand begins with the synthesis of a(n) _____.

An old DNA strand is used as a _____ for the assembly of a new DNA strand.

What catalyzes DNA synthesis?

Which of the following statements about DNA synthesis is true? a) Primers are short sequences that allow the initiation of DNA synthesis. b) As DNA polymerase moves along the template strand, each new nucleotide provides a 5' hydroxyl group for the next reaction to occur. c) DNA polymerase adds dNTP monomers in the 3' to 5' direction. d) Nucleotides are added in a random fashion to single-stranded DNA.

Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis?

Which of the following enzymes creates a primer for DNA polymerase?

Which of the following statements about Okazaki fragments in E. coli is true?

Which of the following enzymes is important for relieving the tension in a helix as it unwinds during DNA synthesis?

True or false? Single-stranded DNA molecules are said to be antiparallel when they are lined up next to each other but oriented in opposite directions.

What is the process called that converts the genetic information stored in DNA to an RNA copy?

DNA does not store the information to synthesize which of the following?

Transcription begins at a promoter. What is a promoter?

Which of the following statements best describes the promoter of a protein-coding gene?

What determines which base is to be added to an RNA strand during transcription?

Which of the following terms best describes the relationship between the newly synthesized RNA molecule and the DNA template strand?

What happens to RNA polymerase II after it has completed transcription of a gene?

Which of the following is/are inputs required for photosynthesis?

The Calvin Cycle occurs in the

Calvin Cycle input

Non-cyclic photophosphorylation produces (outputs)?

A researcher isolates a chloroplast and decreases the pH inside the individual thylakoids. Assuming that there is abundant light energy and CO2 and that there are no other changes to this chloroplast indicate whether the following statement if True or False. This chloroplast will produce more G3P or glucose than a control chloroplast under the same light and CO2 conditions

Based on the previous question indicate whether the following statement is True or False. The experimental chloroplast will produce more ATP than the control chloroplast.

Based on the preceding two questions indicate whether the following statement is True or False. If the researcher also increased the concentration of NADPH +H+ in the stroma of the experimental chloroplast, but not the control, the experimental chloroplast would produce more G3P or glucose.

The backbone of a DNA strand is composed of

Hydrogen bonds must be broken during the process of DNA replication. These bonds occur between?

During RNA processing a(n) _____ is added to the 5' end of the RNA

During RNA processing a(n) _____ is added to the 3' end of the RNA.

Spliceosomes are composed of _____.

The RNA segments joined to one another by spliceosomes are _____.

Translation occurs in the _____.

Which of these correctly illustrates the pairing of DNA and RNA nucleotides?

The direction of synthesis of an RNA transcript is _____.

What enzyme catalyzes the attachment of an amino acid to tRNA?

The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____.

The initiator tRNA attaches at the ribosome's _____ site.

True or false? A codon is a group of three bases that can specify more than one amino acid.

Which of the following statements about mutations is false? a) An addition mutation results in an added base in the DNA sequence. b) A deletion mutation results in the loss of a base in the DNA sequence. c) Addition and deletion mutations disrupt the primary structure of proteins. d) A knock-out mutation results in a total absence of the mutated protein.

If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred?

Which mutation(s) would not change the remainder of the reading frame of a gene sequence that follows the mutation(s)?

If the sequence ATGCATGTCAATTGA were mutated such that a base were inserted after the first G and the third T were deleted, how many amino acids would be changed in the mutant protein?

If a mutated DNA sequence produces a protein that differs in one central amino acid from the normal protein, which of the following kinds of mutations could have occurred?

During transcription the mRNA strand is produced anti-parallel to the template DNA strand.

During the editing of the initial transcript in a eukaryote what is removed from the sequence?

In eukaryotes the mRNA must be processed prior to translation. Where does this mRNA processing occur?

A mRNA molecule contains 246 nucleotides, what is the maximum number of amino acids in the polypeptide translated from this mRNA?

Translation uses the information in mRNA to guide the synthesis of

Enzyme complexes that break down protein are called _____.

The nuclear membrane's role in the regulation of gene expression involves _____.

What is the function of a spliceosome?

Protein-phosphorylating enzymes' role in the regulation of gene expression involves _____.

Which statement(s) about inducible operons is/are correct? a) In an inducible operon, the repressor is synthesized in an active form. b) In an inducible operon, an inducer inactivates the repressor. c) Inducible enzymes generally function in synthetic pathways that produce end products from raw materials.

Which statement(s) about repressible operons is/are correct? a) In a repressible operon, the repressor is synthesized in an active form. b) A repressible operon is on unless a corepressor is present. c) Repressible enzymes generally function in anabolic pathways.

How are genes coordinately controlled in eukaryotic cells? a) Coordinately controlled genes in eukaryotic cells are located together on the same chromosome. b) Coordinately controlled genes in eukaryotic cells share a set of control elements. c) Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals.

Nucleoli are present during _____.

Cytokinesis often, but not always, accompanies _____.

Chromosomes become visible during _____.

Centromeres divide and sister chromatids become full-fledged chromosomes during _____.

Spindle fibers attach to kinetochores during _____.

LOOK AT ONLINE QUIZ 23

During prophase a homologous pair of chromosomes consists of _____.

During _____ both the contents of the nucleus and the cytoplasm are divided.

During _____ the cell grows and replicates both its organelles and its chromosomes.

A friend of yours goes on a diet and loses 15 pounds in two months. Using your knowledge on cellular energetics how did they get rid of the majority of the weight?

Where did most of the mass (dry weight) of this tree come from?

Which of the following best describes the light reactions?

The Calvin Cycle (dark reactions) occurs in the:

inputs and outputs for the Calvin Cycle

Where do we get the energy for the Calvin Cycle from?

Why have so many types of pigments in a photosystem?

What are the inputs and outputs of non-cyclic photophosphorylation?

At night which of the following molecules would be expected to increase concentration inside stroma of the chloroplast?

What is or are the inputs and outputs of Cyclic Photophosphorylation?

Three identical plates of radish seeds were placed in different conditions—list the dry mass in increasing order?

What is the structure of genome?

How is the genome copied?

What is the genome used for?

DNA replication involves making _____ from DNA.

DNA replication occurs in a ___ mechanism.

What happens if the wrong base is added?

Where does the energy come from?

Why does DNA polymerase only build 5' to 3'?

Can errors in DNA be repaired after replication?

What mRNA sequence would this DNA molecule produce? 5' TATAAATGTCCACTGCGGTC

Which of the following best describes transcription?